Frared absorbing secondary antibody (Odyssey? for 1 h at room temperature. Membranes were washed again

Frared absorbing secondary antibody (Odyssey? for 1 h at room temperature. Membranes were washed again and protein bands revealed using the Odyssey?LI-COR imaging system. Twenty paired CRC/ NT samples were analyzed for each antibody. Protein expression fold-changes between 20 CRC and paired NT were evaluated by densitometry analysis, using Hsc-70 as normalization control.ImmunohistochemistrySaint-Herblain, France) dried overnight at 37 before processing. IHC processing was performed on a Ventana Benchmark XT?automated slide preparation system (Roche Diagnostics, Meylan, France) using the UltraView Universal DAB Detection Kit (Roche Diagnostics). The following antibodies were used: NME1 (mouse monoclonal antibody, clone 1D7, Abnova, 1:200 diluted), FDPS (rabbit monoclonal antibody, clone EPR4628, Epitomics, 1:400) and CCND1 (rabbit monoclonal antibody, clone SP4, Thermo Scientific). The slides were pre-treated with cell conditioner 1 (pH 8) for 30 min., followed by incubation with each antibody at 37 for 1 h. After washing, the slides were counterstained with one drop of hematoxylin for 12 min and one drop of bluing reagent for 4 min. Slides were next washed in water with dishwashing detergent and mounted. For each case, the staining intensities were compared between the adenocarcinoma glands and the adjacent normal glands. Staining of the stroma was also noted.Real-time polymerase chain reactionFormalin-fixed and paraffin-embedded samples of colorectal adenocarcinomas PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28461567 (n = 27, same patients used for Western blot analyses, Table 1) were used for the immuno-histochemical (IHC) analyses. For each case, a block containing adenocarcinoma areas and adjacent normal mucosa was selected. Immuno-histochemical techniques were performed for each case on 4 m formalin-fixed and paraffin-embedded tissue sections mounted on Superfrost?Plus slides (Thermo Scientific,To evaluate the impact of drug treatment on the transcript content of HCT-116 and HT-29 cells, the differential expression of selected genes was analyzed by real time PCR (StepOne plus, Applied Biosystems). Briefly, total RNA was extracted using TRIzol?reagent according to the manufacturer’s instructions (Invitrogen, France). Two micrograms of total RNA were reverse-transcribed using random hexamers and M-MLV (Moloney-murine-leukaemia virus) reverse transcriptase (New England Biolabs, France). Retro-transcribed RNA ( 5 ng cDNA) was used as template for all PCR experiments (except for the 18S ribosomal RNA which was amplified from 5 pg cDNA). PCR was performed with the Power SYBR GREEN PCR Anlotinib chemical information Master Mix, according to the manufacturer’s instructions (Applied Biosystems). All conditions were normalized relative to the 18S control rRNA. Primer sequences (and amplicons lengths) were: TCACTTGTGGCCCAGATAGGC and GGATGCCTTTGTGGAACTGT for BCL2 (136pb), AGGTTTAGCGCCACTCTGC and GAGCCTCAACATCCGACTCC for CHECK2 (98pb), TGCAGT GTCTCGGGACTTCG and CGCTGGTGTGGAACATC TGG for CYP11A1 (218pb), TGGAGGAATGGTATACCCTG and TCCTTTGACTGATGATGAAGTAGC for CYP51A1 (310pb), ATTTGGAGCACAGGTGTCTA and TGTCATTGGTGACGCCATCT for DHCR7(163pb), CCTGCACACCTTCCAAAACG and GTAGCAGTCGGCATACAGC for DHCR24 (236pb), TGTGGCACCAGATGTCTTCG and GCTGTGGCAGGGAGTCTTG for HMGCS1(271pb),TTCTGCAGCTCTGTGTGAAGG and TTTGGGGTGGAAAGGTTTGG for IL8 (97pb), GGAG TGGCTTTCCTGAGAAC and GGTGAGAAGCTGGC TGAGAG for ITGA2 (285pb), AAAGGATTCCGC CTTGTTGGT and GCCCTGAGTGCATGTATTTCACDurand et al. BMC Genomics (2017) 18:Page 5 offor NME1 (124pb), TCCTGTATGGCTCCGAGACC.